Apis mellifera (honey bee) microRNA ame-mir-34 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apis mellifera (honey bee) microRNA ame-mir-34 precursor URS000075AC91_7460

100 nucleotides
4 databases (ENA, Ensembl Metazoa, miRBase, RefSeq)
Found in 0 other species
4202 publications
1. transcript
2. pre-miRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ame-mir-34: Ame-mir-34 is a microRNA that was analyzed using the 2−ΔΔCt method to determine its relative expression level [PMC9863880]. In the 4-day-old larval gut, the upregulation of ame-mir-34 was observed, but there was no significant difference in its expression level between the A. apis + mimic-miR-34 group and A. apis + mimic-NC group [PMC9863880]. This suggests that there may be other unknown factors influencing the regulation of abct expression at this stage [PMC9863880].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UUUUUUUGCGAUUGGCAUGUUGGCAGUGUUGUUAGCUGGUUGUGUGGCUACAUUGUAUAUACGACCGCUAUCGGCACUGCAAUUAUGACGAUCGUAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure

Publications