v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 581 (LINC00581) URS000075AAC4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00581: LINC00581 is a long non-coding RNA (lncRNA) that has been identified as one of the hub lncRNAs in a study on papillary thyroid carcinoma (PTC) patients [PMC8906208]. The study used a diagnostic model built with logistic regression, which included LINC00581 along with other lncRNAs [PMC8906208]. The expression levels of LINC00581 were found to be low in PTC patients with poor outcomes [PMC8906208]. Additionally, a LASSO Cox regression model was constructed, and LINC00581 was identified as one of the low-risk lncRNAs along with LINC01176 and LINC01290 [PMC8906208]. These findings suggest that low expression of LINC00581 may be associated with poor prognosis in PTC patients [PMC8906208]. Reference: [PMC8906208] Li, Y., Li, Y., Chen, Y., Xie, Q., Dong, N., & Chen, X. (2020). Identification of hub long non-coding RNAs associated with prognosis in papillary thyroid carcinoma. Aging (Albany NY), 12(24), 25212–25224. https://doi.org/10.18632/aging.202345

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUGGGGCUUCACCACGUUGGCCAGGCUGGUCUUGAACUCCUGAGCUCAAGUGAUCUGCCUGCCUUGGCCUCCCAAAGUGCUGGGACUAUGGGCUUGAGCUACUGUGCCCAGCCGUGCCUGCCUCUUUAGACACAUCAAAAUCCGCCUCUGUGAUUUUUGCUUAUGGCCAUAUAGAGGCAAUUUGAGGUUCACCAACCACAAGGGAAGUAGCUCCCUGCCUUCAUGAGGCUCUGAUACACUAUAAACCUUCCAUUCAGAACCUGUGAUGGAGUCGAGUGUGUAGCCCUAGCUACUUGGGAGGUCAAGGGAAGAGGAUCACUUGAGCCCAGGAGUUUGAGACCAGCUUGAGCAAUGCGAACUGGAAAUAUCGACAAACAGCACUGAAGGCUCCUGGUCUACCACAGGAGGUGAUCUCUAGUGAAGAAGGUUGAGAUUUGCAUGCAGAAUUUCCAGAAUGCUGAAUAUCAGCACGGAUCACUGCAAAGAAGUUGGAACUCAUCUCACAUGAACUUCUCAGGUUCUCUUACAAGACCACCAACAUUCUUCAAACAUCAGUGAAAUAAAACAGGAGGAGGGUUUCGAGCUCUGGAUCCUCAGCCUGGAAAUGUCACAAUUUAAUCCCAAAGGUUUGCUGUGAAGUUGUAAGCAUGACAGUGUGAAACUCGACAGAUUAUUCUUGAAUUCUUUGUUUGUUUUCGUUGUGACCCGACUCUCAUAAAAUUUAUGUUUUCUUCCAAACCCCCAGGGUGUGUGGUCAUAUGACUUAAAUAGAGAAAAACAUUGUCAAAACAGUAUUGAGGAGUUAUCACUUUUACAUUGUUUUAAUUAAAGAAAAAGCCUUUCUAUCCAGGUCUAAUACCAUCAUUUUUAUGGGCAUGUUAAAGUAUCUAAUCUAAUACUGUAGUUAGUAGUAGUAUUUAGUAUUUUUAGUAUUAUUAUAGUUUUAUCUGUAUCUUAAAGAAAAAGUCAAUAAAUAUGAAAACAGAAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications