Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca nemestrina (Pig-tailed macaque) miRNA MIR124-1 (ENSMNEG00000002972.1) URS000075A939_9545

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 89 other species

    1. Ailuropoda melanoleuca microRNA 124-1 (ENSAMEG00000030170.1)
    2. Aotus nancymaae miRNA MIR124-1 (ENSANAG00000014020.1)
    3. Balaenoptera musculus microRNA 124-1 (ENSBMSG00010012221.1)
    4. Bos grunniens miRNA (ENSBGRG00000002224.1, ENSBGRG00000002230.1)
    5. Bos mutus (wild yak) miRNA (ENSBMUG00000003238.1)
    6. Bos taurus microRNA bta-mir-124a precursor (bta-mir-124a-1)
    7. Callithrix jacchus (white-tufted-ear marmoset) cja-mir-124-2 (ENSCJAG00000030494.3)
    8. Camelus dromedarius microRNA 124-1 (ENSCDRG00005020155.1)
    9. Canis lupus dingo microRNA 124-1 (ENSCAFG00020012076.1)
    10. Canis lupus familiaris (dog) miRNA (ENSCAFG00000020462.2, ENSCAFG00030025142.1, ENSCAFG00040022770.1, ENSCAFG00845020727.1)
    11. Capra hircus (Goat) miRNA (ENSCHIG00010005974.1)
    12. Castor canadensis miRNA (ENSCCNG00000016566.1)
    13. Catagonus wagneri (Chacoan peccary) microRNA 124-1 (ENSCWAG00000018786.1)
    14. Cavia porcellus microRNA 124-1 (ENSCPOG00000017157.3)
    15. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000000196.1)
    16. Cervus hanglu yarkandensis (Yarkand deer) microRNA 124-1 (ENSCHYG00000015227.1)
    17. Chinchilla lanigera (Long-tailed chinchilla) miRNA (ENSCLAG00000020873.1)
    18. Chlorocebus sabaeus (African green monkey) miRNA (ENSCSAG00000022038.1)
    19. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000037717.1)
    20. Cricetulus griseus miRNA (ENSCGRG00000021091.1, ENSCGRG00001005985.1, ENSCGRG00015010046.1)
    21. Delphinapterus leucas (beluga whale) microRNA 124-1 (ENSDLEG00000000482.1)
    22. Dipodomys ordii (Ord's kangaroo rat) microRNA 124a-1 (ENSDORG00000021073.2)
    23. Echinops telfairi microRNA 124-1 (ENSETEG00000020671.1)
    24. Equus asinus asinus microRNA 124-1 (ENSEASG00005016377.1)
    25. Equus caballus miRNA MIR124-1 (ENSECAG00000026074.2)
    26. Felis catus miRNA (ENSFCAG00000016440.3)
    27. Fukomys damarensis miRNA (ENSFDAG00000001415.1)
    28. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 124-1 (ENSGGOG00000028677.2)
    29. Heterocephalus glaber (naked mole-rat) microRNA 124-1 (ENSHGLG00000022161.1, ENSHGLG00100023964.1)
    30. Homo sapiens microRNA hsa-mir-124 precursor (hsa-mir-124-1)
    31. Ictidomys tridecemlineatus microRNA 124-1 (ENSSTOG00000023130.1)
    32. Lynx canadensis (Canada lynx) microRNA 124-1 (ENSLCNG00005011041.1)
    33. Macaca fascicularis (Crab-eating macaque) miRNA (ENSMFAG00000012645.2)
    34. Macaca mulatta microRNA mml-mir-124a precursor (mml-mir-124a-2)
    35. Mandrillus leucophaeus miRNA (ENSMLEG00000014055.1)
    36. Marmota marmota marmota (Alpine marmot) microRNA 124-1 (ENSMMMG00000012471.1)
    37. Meriones unguiculatus miRNA (ENSMUGG00000022585.1)
    38. Mesocricetus auratus (Golden Hamster) miRNA (ENSMAUG00000006923.1)
    39. Microtus ochrogaster (vole) microRNA 124a-1 (ENSMOCG00000007009.1)
    40. Monodelphis domestica microRNA mdo-mir-124a precursor (mdo-mir-124a-1)
    41. Monodon monoceros microRNA 124-1 (ENSMMNG00015016191.1)
    42. Moschus moschiferus (Siberian musk deer) microRNA 124-1 (ENSMMSG00000002499.1)
    43. Mus caroli microRNA 124a-1 (MGP_CAROLIEiJ_G0007382.1)
    44. Mus musculus microRNA mmu-mir-124 precursor (mmu-mir-124-1)
    45. Mus pahari microRNA 124a-1 (MGP_PahariEiJ_G0007729.1)
    46. Mus spicilegus microRNA 124a-1 (ENSMSIG00000014466.1)
    47. Mus spretus (algerian mouse) microRNA 124a-1 (MGP_SPRETEiJ_G0007740.1)
    48. Mustela putorius furo microRNA 124-1 (ENSMPUG00000022588.1)
    49. Nannospalax galili (Upper Galilee mountains blind mole rat) miRNA (ENSNGAG00000004506.1)
    50. Neogale vison microRNA 124-1 (ENSNVIG00000005843.1)
    51. Nomascus leucogenys miRNA MIR124-1 (ENSNLEG00000023246.2)
    52. Notamacropus eugenii microRNA 124-1 (ENSMEUG00000016940.1)
    53. Ochotona princeps miRNA (ENSOPRG00000017600.1)
    54. Octodon degus (Degu) miRNA (ENSODEG00000021775.1, ENSODEG00000021776.1)
    55. Oryctolagus cuniculus (rabbit) microRNA 124-1 (ENSOCUG00000018923.2)
    56. Otolemur garnettii miRNA MIR124-1 (ENSOGAG00000027596.1)
    57. Ovis aries (sheep) miRNA (ENSOARG00000022410.1, ENSOARG00020007027.1)
    58. Pan paniscus miRNA MIR124-1 (ENSPPAG00000009149.1)
    59. Panthera leo miRNA MIR124-1 (ENSPLOG00000000302.1)
    60. Panthera pardus miRNA (ENSPPRG00000014484.1)
    61. Panthera tigris altaica (Tiger) miRNA MIR124-1 (ENSPTIG00000001740.1)
    62. Pan troglodytes miRNA MIR124-1 (ENSPTRG00000046974.1)
    63. Papio anubis (olive baboon) miRNA MIR124-1 (ENSPANG00000004561.3)
    64. Peromyscus maniculatus bairdii microRNA 124a-1 (ENSPEMG00000005499.2)
    65. Phocoena sinus microRNA 124-1 (ENSPSNG00000014207.1)
    66. Physeter catodon microRNA 124-1 (ENSPCTG00005002552.1)
    67. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000033071.1)
    68. Pongo abelii (Sumatran orangutan) microRNA 124-1 (ENSPPYG00000037897.1)
    69. Procavia capensis microRNA 124-1 (ENSPCAG00000019176.1)
    70. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000011577.1)
    71. Propithecus coquereli miRNA (ENSPCOG00000009569.1)
    72. Rattus norvegicus (Norway rat) microRNA rno-mir-124 precursor (rno-mir-124-1)
    73. Rhinolophus ferrumequinum microRNA 124-1 (ENSRFEG00010015465.1)
    74. Rhinopithecus bieti (Black snub-nosed monkey) miRNA MIR124-1 (ENSRBIG00000009153.1)
    75. Rhinopithecus roxellana miRNA (ENSRROG00000003359.1)
    76. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000016788.1)
    77. Sarcophilus harrisii miRNA (ENSSHAG00000028983.1)
    78. Sciurus vulgaris microRNA 124-1 (ENSSVLG00005000363.1)
    79. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000011724.1)
    80. Suricata suricatta microRNA 124-1 (ENSSSUG00005011299.1)
    81. Sus scrofa microRNA ssc-mir-124a precursor (ssc-mir-124a-2)
    82. Theropithecus gelada microRNA 124-1 (ENSTGEG00000015876.1)
    83. Tursiops truncatus microRNA 124-1 (ENSTTRG00000022226.1)
    84. Urocitellus parryii microRNA 124-1 (ENSUPAG00010003385.1)
    85. Ursus americanus microRNA 124-1 (ENSUAMG00000027634.1)
    86. Ursus maritimus microRNA 124-1 (ENSUMAG00000021825.1)
    87. Ursus thibetanus thibetanus microRNA 124-1 (ENSUTTG00000001124.1)
    88. Vulpes vulpes microRNA 124-1 (ENSVVUG00000002525.1)
    89. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015000602.1)
    90. Equus asinus None
    91. Cebus imitator None
    Publications