Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-378d precursor (hsa-mir-378d-2) URS000075A8D8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR378D2: MIR378D2 is a type of microRNA that is expressed in most cell lines and ranks as the second highest in esophageal cell lines [PMC8697470]. It is part of the miR-378d family, which consists of two different chromosomes in humans, namely MIR378D1 and MIR378D2 [PMC8697470]. The target genes of LINC00665 and MIR378D2 are significantly enriched in the ubiquitin-dependent protein catabolic process, ubiquitin-protein ligase activity, and the neurotrophin signaling pathway [PMC6012059]. These target genes are mainly involved in regulating ubiquitin-dependent protein catabolism and response to calcium ion [PMC6012059]. In a study, RP4-684O24, RP11-283I3, and RP11-350G8 were found to coregulate 60 differentially expressed genes (DEGs), while LINC00665 and MIR378D2 coregulated 55 DEGs [PMC6012059]. These findings suggest that MIR378D2 plays a role in regulating protein catabolism and calcium ion response through its target genes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAUGGUUACAAGGAGAGAACACUGGACUUGGAGUCAGAAAACUUUCAUCCAAGUCAUUCCCUGCUCUAAGUCCCAUUUCUGUUCCAUGAGAUUGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications