Cricetulus griseus (Chinese hamster) miRNA (ENSCGRG00000021223.1, ENSCGRG00001001453.1, ENSCGRG00015022000.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cricetulus griseus (Chinese hamster) miRNA (ENSCGRG00000021223.1, ENSCGRG00001001453.1, ENSCGRG00015022000.2) URS000075A86D_10029

76 nucleotides
1 database (Ensembl)
Found in 2 other species
10 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGGCAAGUGGAGGAGCAGCAGGGUGAAACUGACACAGUUCUGGUGAGUUUCACUUUGCUGCUCCUCCUGAUUCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Rattus norvegicus (Norway rat) microRNA rno-mir-761 precursor

Publications