Homo sapiens (human) microRNA hsa-mir-4275 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4275 precursor URS000075A242_9606

87 nucleotides
6 databases (Ensembl, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
Found in 3 other species
13 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

ACAUUUUUGUCCAAUUACCACUUCUUUUUGCCACCUGAGCACAGUCAGCAGUCAGCAUAAAAAAGUGAUAAUGGGAAGUUAAUGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Gorilla gorilla gorilla microRNA 4275 (ENSGGOG00000040740.1)
Pan paniscus (bonobo) microRNA 4275 (ENSPPAG00000002941.1)
Pan troglodytes microRNA 4275 (ENSPTRG00000047660.1)

Publications