Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4443 precursor URS0000759B7F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4443: MIR4443 is a highly expressed microRNA in non-SC-EVs [PMC9800941]. A systematic review and meta-analysis revealed that upregulated MIR4443 is associated with better prognosis [PMC7827149]. Bioinformatics analysis identified METTL3 as a target gene of MIR4443 [PMC9617873]. In a study assessing the normalization of miRNA expression, MIR4443 was one of the miRNAs analyzed [PMC7035418]. However, the specificity of MIR4443 to Graves' disease was not investigated in patients with other autoimmune diseases [PMC5671953]. Additionally, MIR4443 has been found to inhibit cisplatin-induced ferroptosis by regulating AIFM2 expression in an m6A-dependent manner through METTL3 [PMC8572460]. In summary, MIR4443 is a highly expressed microRNA that has been associated with better prognosis and identified as a target gene for METTL3. It has also been analyzed in the context of miRNA normalization and its specificity to Graves' disease. Furthermore, its role in inhibiting cisplatin-induced ferroptosis has been elucidated.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUGGGGGUUGGAGGCGUGGGUUUUAGAACCUAUCCCUUUCUAGCCCUGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications