Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-126 precursor URS0000759B6D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR126: MIR126 is a microRNA that has been studied in various contexts. It has been found to be downregulated in the retinal tissue of streptozotocin-induced diabetic rats [PMC7932804]. In human lung tissue, there is a significant inverse correlation between ADAM9 expression and MIR126 expression [PMC9756782]. Disruption of MIR126, but not EGFL7, has been shown to lead to phenotypic changes in animals [PMC3960138]. MIR126 has also been found to induce complex metabolic reprogramming of MM cells, including activation of the autophagic pathway and downregulation of PDK and ACL activity [PMC5095004]. In AFS cells, MIR126 is detectable at the basal state [PMC4628318]. It plays a role in altering energy metabolism and facilitating tumor progression [PMC9779381]. Low levels of MIR126 are associated with a high risk for CoAD [PMC7123062]. The expression pattern of caspase 3 and MIR126 in EPCs is similar to that in their parent cells [PMC3830832]. In patients with PAAD, MIR126 is significantly associated with overall survival [PMC6005310]. The downregulation of miR-106a, miR-146a, miR-150, miR-16, miR-17, miR-19b, miR-20a, miR-223, miR-24, and miR-92a has also been observed in ovarian cancer samples compared to control samples [PMC6571871]. Housekeepers such as miRNA191 were measured against MIR126 and other microRNAs for comparison purposes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGCUGGCGACGGGACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGUGAGUAAUAAUGCGCCGUCCACGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications