Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-570 precursor URS0000759B29_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR570: MIR570 is a microRNA that has been implicated in various biological processes and diseases. It has been identified as one of the top features in a classification model that achieved a high accuracy of 0.9 [PMC9589260]. In the context of right ventricular hypertrophy (VH), circRNA-0068481 has been found to regulate the expression of MIR570, promoting the pathological progression of VH [PMC9589260]. MIR570 is also closely related to heart failure, as it is one of 13 genes identified in a study investigating HF [PMC9589260]. In terms of ceRNA axes, MIR570 is involved in interactions with two DElncRNAs and seven miRNAs [PMC9671706]. Additionally, MIR570 expression can be induced by hypoxia in a HIF-dependent manner [PMC8760265]. The rs4143815 variant of MIR570 has been associated with protection against multibacillary (MB) leprosy and decreased expression according to the GTEx database [PMC9503809]. Furthermore, MIR570 can regulate the expression of chemokines CCL4 and CCL5, indicating its involvement in inflammatory regulation [PMC9503809]. Genetic variants in miRNA genes including MIR570 have also been associated with leprosy risk and its different forms [PMC9503809]. In various diseases such as Parkinson's disease and cancer, including hepatocellular carcinoma and colon cancer, MIR570 has been implicated as a potential biomarker or regulator [PMC7523356][PMC4822961][PMC7529545][PMC8640083][PMC7816704].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUAGAUAAGUUAUUAGGUGGGUGCAAAGGUAAUUGCAGUUUUUCCCAUUAUUUUAAUUGCGAAAACAGCAAUUACCUUUGCACCAACCUGAUGGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications