Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-208a precursor URS0000759A9B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR208A: MIR208A is a microRNA that has been found in isolated exosomes of patients with lung cancer and has been shown to modulate radioresistance in recipient cells [11]. Exosomal miRNAs have also been found to have dose-related effects during thoracic radiation treatment [PMC6525830]. Primers from QIAGEN® were used to detect the expression of miR499, MIR208A, and U6 [PMC7957261]. In the context of acute myocardial infarction, MIR208A expression is increased in circulating exosomes and may affect bone marrow stem cells [PMC9501315]. In a study on cardiac development, MIR208A expression levels were found to be upregulated in day 10 populations compared to day 6 populations [PMC6828809]. MIR208A is involved in the switch from Myh6 to Myh7 isoforms during hypertrophy and is required for this shift under conditions of mechanical stress and hypothyroidism [PMC5586433]. The inactivation of MIR208A by antagomir-208a was demonstrated by co-transfecting miR-208a + antagomir-208a + GFP-PDE4D3′UTR into HEK cells without altering GFP expression [PMC5105063]. Gain of MIR208A function through transfection of miR-208a has been shown to increase levels of cAMP and PKA, supporting its involvement in the cAMP/PKA signaling pathway [PMC5105063]. Additionally, MIR208A may play a role in cardiac fibrosis formation in congenital heart disease as well as acquired heart disease [PMC3879305]. The myogenic miRNAs including MIR1-1, MIR133A1, MIR208A, and MIR499A are expressed by day 10 during pluripotent stem cell differentiation into the cardiac lineage [PMC6828809].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACGGGCGAGCUUUUGGCCCGGGUUAUACCUGAUGCUCACGUAUAAGACGAGCAAAAAGCUUGUUGGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications