Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000013740.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000013740.1) URS0000759A9B_37293

71 nucleotides
1 database (Ensembl)
Found in 11 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGACGGGCGAGCUUUUGGCCCGGGUUAUACCUGAUGCUCACGUAUAAGACGAGCAAAAAGCUUGUUGGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Bos taurus microRNA bta-mir-208a precursor
Capra hircus microRNA 208a (ENSCHIG00000009204.1)
Cebus imitator (Panamanian white-faced capuchin) miRNA (ENSCCAG00000011857.1, ENSCCAG00000013444.1)
Gorilla gorilla gorilla microRNA 208a (ENSGGOG00000031335.2)
Homo sapiens microRNA hsa-mir-208a precursor
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 208a (ENSNLEG00000024933.2)
Pan paniscus (bonobo) microRNA 208a (ENSPPAG00000019998.1)
Pan troglodytes ptr-mir-208a (ENSPTRG00000027684.3)
Prolemur simus miRNA (ENSPSMG00000007527.1)
Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 208a (ENSRFEG00010002103.1)
Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000006301.1)