Homo sapiens (human) microRNA hsa-mir-199a precursor (hsa-mir-199a-1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-199a precursor (hsa-mir-199a-1) URS0000759977_9606

71 nucleotides
8 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
Found in 8 other species
1010 publications
1. transcript
2. pre-miRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR199A1: MIR199A1 is a microRNA that has been studied in various contexts. In a study using the miR-VILO kit, it was found that MIR199A1 was significantly upregulated following 48 hours of Bb infection [PMC5279786]. MIR199A1 is one of the microRNAs validated in the GSE94462 dataset [PMC9922242]. It is also available for purchase from OriGene [PMC7228945]. MIR199A1 is located on chromosome 19 and shares a domain with miR21 and miR155 genes, suggesting functional partnerships [PMC9962339]. In hypospadias, MIR199A1 was identified as one of the potentially associated non-coding RNAs [PMC9834259]. The human genome has two genes encoding mature miR-199a-3p, with MIR199A1 on chromosome 19 and MIR199A2 on chromosome 1 [PMC9177676]. Differential expression of non-coding RNAs, including MIR199A1, may play a role in tumor differentiation [PMC7433108]. Overall, these studies highlight the significance of MIR199A1 in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUGUACAGUAGUCUGCACAUUGGUUAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.