Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000022046.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000022046.2) URS0000759977_9601

71 nucleotides
2 databases (ENA, Ensembl)
Found in 8 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUGUACAGUAGUCUGCACAUUGGUUAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Colobus angolensis palliatus miRNA (ENSCANG00000005313.1)
Gorilla gorilla gorilla microRNA 199a-1 (ENSGGOG00000032910.2)
Homo sapiens microRNA hsa-mir-199a precursor (hsa-mir-199a-1)
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 199a-1 (ENSNLEG00000024605.2)
Pan paniscus (bonobo) microRNA 199a-1 (ENSPPAG00000002500.1)
Pan troglodytes ptr-mir-199a-1 (ENSPTRG00000027731.2)
Rhinopithecus bieti miRNA (ENSRBIG00000009227.1)
Rhinopithecus roxellana miRNA (ENSRROG00000027310.1)

2D structure