v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Callithrix jacchus tRNA-Leu (CAA) (tRNA-Leu-CAA-4-1) secondary structure diagram

Callithrix jacchus tRNA-Leu (CAA) (tRNA-Leu-CAA-4-1) URS0000735371_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCAGGAUGGCCGAGUGGUCUAAGGCGCCAGACUCAAGUUCUGGUCUCCGGAUGGAGGCGUGGGUUCGAAUCCCACUUCUGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Canis lupus familiaris tRNA-Leu (CAA) (tRNA-Leu-CAA-3-1)
  2. Chlorocebus sabaeus tRNA-Leu (CAA) (tRNA-Leu-CAA-2-1)
  3. Dipodomys ordii tRNA-Leu (CAA) (tRNA-Leu-CAA-3-1)
  4. Gorilla gorilla gorilla tRNA-Leu (CAA) (tRNA-Leu-CAA-4-1)
  5. Homo sapiens tRNA-Leu (anticodon CAA) 4-1 (TRL-CAA4-1)
  6. Macaca mulatta tRNA-Leu (CAA) (tRNA-Leu-CAA-3-1)
  7. Nomascus leucogenys tRNA-Leu (CAA) (tRNA-Leu-CAA-5-1)
  8. Pan troglodytes tRNA-Leu (CAA) (tRNA-Leu-CAA-5-1)
  9. Papio anubis tRNA-Leu (CAA) (tRNA-Leu-CAA-3-1)
  10. Pongo abelii tRNA-Leu (CAA) (tRNA-Leu-CAA-4-1)
  11. Saimiri boliviensis boliviensis tRNA-Leu (CAA) (tRNA-Leu-CAA-4-1)
 2D structure Publications