Rattus norvegicus (Norway rat) microRNA rno-mir-34b precursor URS000072DC85_10116

• 84 nucleotides
• 4 databases (Ensembl, miRBase, RefSeq, RGD)
• Found in 6 other species
• 100 publications
• 1. transcript
  2. pre-miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

GUGCUCGGUUUGUAGGCAGUGUAAUUAGCUGAUUGUAGUGCGGUGCUGACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

1. Mus caroli (Ryukyu mouse) microRNA 34b (MGP_CAROLIEiJ_G0008268.1)
2. Mus musculus microRNA mmu-mir-34b precursor
3. Mus pahari microRNA 34b (MGP_PahariEiJ_G0006669.1)
4. Mus spicilegus (steppe mouse) microRNA 34b (ENSMSIG00000007901.1)
5. Mus spretus microRNA 34b (MGP_SPRETEiJ_G0008706.1)

Publications Download

• FASTA
• JSON