Mus pahari (Shrew mouse) microRNA 34b (MGP_PahariEiJ_G0006669.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus pahari (Shrew mouse) microRNA 34b (MGP_PahariEiJ_G0006669.1) URS000072DC85_10093

84 nucleotides
1 database (Ensembl)
Found in 7 other species
89 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GUGCUCGGUUUGUAGGCAGUGUAAUUAGCUGAUUGUAGUGCGGUGCUGACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Mus caroli (Ryukyu mouse) microRNA 34b (MGP_CAROLIEiJ_G0008268.1)
Mus musculus microRNA mmu-mir-34b precursor
Mus spicilegus (steppe mouse) microRNA 34b (ENSMSIG00000007901.1)
Mus spretus microRNA 34b (MGP_SPRETEiJ_G0008706.1)
Rattus norvegicus (Norway rat) microRNA rno-mir-34b precursor

Publications