Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-504 precursor URS00006F1C02_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR504: MIR504 is a microRNA that has been implicated in cell cycle regulation via the p53 pathway and has been found to be downregulated in neurological disorders [PMC6031650]. It has been identified as a potential therapeutic target for ALS due to its involvement in apoptosis and synaptic vesicle regulation [PMC6031650]. In wheat, MIR504 is one of the 58 identified wheat miRNAs, and it shows ubiquitous expression in all examined tissues [PMC5360763] [PMC2394755]. It has been found to target wheat unigenes Ta.5303 and Ta.39646, which have two complementary sites for MIR504 [PMC2394755]. The expression of MIR504, along with other wheat miRNAs, has been validated using semi-quantitative RT-PCR [PMC2394755]. In diabetic subjects, MIR504 is upregulated and targets the adaptor GRB10 and transcription factor EGR2 [PMC7123062]. It has also been identified as a p53-related oncomiR that downregulates p53 expression and is associated with aggressive cancer behavior in both human and animal models [PMC9495382]. Exosomal miRs such as MIR504 have been implicated in insulin resistance, diabetes-related hypertension, and vascular dysfunction [PMC8516748]. Transfection experiments have used MIR504 mimic or inhibitor to study its effects on cell culture [PMC8425090]. Future studies are needed to explore the links between obesity-related hormones, MIR504, and p53 [PMC3696069]. Dysregulation of miR-34a and MIR504 has also been observed in various diseases related to synaptic vesicle regulation and cell survival[ PMC6349704].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGCUGUUGGGAGACCCUGGUCUGCACUCUAUCUGUAUUCUUACUGAAGGGAGUGCAGGGCAGGGUUUCCCAUACAGAGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications