v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-452 precursor URS00006BFE9D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR452: MIR452, a microRNA, has been found to be upregulated in both colorectal cancer (CRC) and dextran sulfate sodium (DSS)-induced mouse colitis tissues [PMC6826374]. It has been shown to regulate two VEGFA-VEGFR2-mediated signaling pathways, namely VEGFR2-SRC-PTK2 and VEGFR2-KRAS-BRAF-MAPK [PMC6826374]. Through these pathways, MIR452 has been found to regulate cell growth, cell migration, and angiogenesis in CRC cells via the VEGFA-VEGFR2 pathway [PMC6826374]. Additionally, when cells were co-transfected with a MIR452 mimic, the luciferase intensity was reduced by approximately 15% [PMC6826374]. Reference: [PMC6826374] Zhang YF et al. (2019) MIR452 regulates cell growth and angiogenesis through targeting of the VEGFA-VEGFR2 signaling pathway in colorectal cancer. World J Gastroenterol 25(43):6419-6433.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUAAGCACUUACAACUGUUUGCAGAGGAAACUGAGACUUUGUAACUAUGUCUCAGUCUCAUCUGCAAAGAAGUAAGUGCUUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Carlito syrichta microRNA 452 (ENSTSYG00000026437.1)
  2. Castor canadensis miRNA (ENSCCNG00000001089.1)
  3. Chlorocebus sabaeus microRNA mir-452
  4. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000005202.1)
  5. Gorilla gorilla gorilla microRNA 452 (ENSGGOG00000030705.2)
  6. Gorilla gorilla (western gorilla) microRNA mir-452
  7. Macaca mulatta microRNA mml-mir-452 precursor
  8. Macaca nemestrina (Pig-tailed macaque) microRNA 452 (ENSMNEG00000006688.1)
  9. Nomascus leucogenys microRNA 452 (ENSNLEG00000021525.2)
  10. Oryctolagus cuniculus microRNA 452 (ENSOCUG00000023918.1)
  11. Otolemur garnettii microRNA 452 (ENSOGAG00000017262.1)
  12. Pan paniscus microRNA 452 (ENSPPAG00000002347.1)
  13. Pan troglodytes ptr-mir-452 (ENSPTRG00000027729.2, ENSPTRG00000052231.1)
  14. Pongo abelii (Sumatran orangutan) microRNA mir-452
  15. Pongo pygmaeus microRNA ppy-mir-452 precursor
  16. Prolemur simus microRNA 452 (ENSPSMG00000018231.1)
 Publications