v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Castor canadensis (American beaver) miRNA (ENSCCNG00000001089.1) URS00006BFE9D_51338

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUAAGCACUUACAACUGUUUGCAGAGGAAACUGAGACUUUGUAACUAUGUCUCAGUCUCAUCUGCAAAGAAGUAAGUGCUUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Carlito syrichta microRNA 452 (ENSTSYG00000026437.1)
  2. Chlorocebus sabaeus microRNA mir-452
  3. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000005202.1)
  4. Gorilla gorilla gorilla microRNA 452 (ENSGGOG00000030705.2)
  5. Gorilla gorilla (western gorilla) microRNA mir-452
  6. Homo sapiens microRNA hsa-mir-452 precursor
  7. Macaca mulatta microRNA mml-mir-452 precursor
  8. Macaca nemestrina (Pig-tailed macaque) microRNA 452 (ENSMNEG00000006688.1)
  9. Nomascus leucogenys microRNA 452 (ENSNLEG00000021525.2)
  10. Oryctolagus cuniculus microRNA 452 (ENSOCUG00000023918.1)
  11. Otolemur garnettii microRNA 452 (ENSOGAG00000017262.1)
  12. Pan paniscus microRNA 452 (ENSPPAG00000002347.1)
  13. Pan troglodytes ptr-mir-452 (ENSPTRG00000027729.2, ENSPTRG00000052231.1)
  14. Pongo abelii (Sumatran orangutan) microRNA mir-452
  15. Pongo pygmaeus microRNA ppy-mir-452 precursor
  16. Prolemur simus microRNA 452 (ENSPSMG00000018231.1)