Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bacillus subtilis subsp. subtilis str. 168 Bacillaceae-1 RNA secondary structure diagram

Bacillus subtilis subsp. subtilis str. 168 Bacillaceae-1 RNA URS000065A032_224308

Automated summary: This ncRNA sequence is 67 nucleotides long and is found in Bacillus subtilis subsp. subtilis str. 168. Annotated by 2 databases (ZWD, Rfam). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (Bacillaceae-1, RF01690).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUAAAUGGAUCACAGGUUAAGUUCACCGCAUCCUGCGGCGACACCUGUGUGACCUGCGUCGUGCAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 9 other species

    1. Bacillus sp. AtDRG31 Bacillaceae-1 RNA
    2. Bacillus sp. SJZ110 Bacillaceae-1 RNA
    3. Bacillus subtilis Bacillaceae-1 RNA
    4. Bacillus subtilis subsp. subtilis Bacillaceae-1
    5. Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 = DSM 10 Bacillaceae-1 RNA
    6. Bacillus subtilis subsp. subtilis str. JH642 Bacillaceae-1 RNA
    7. Bacillus subtilis subsp. subtilis str. SMY Bacillaceae-1 RNA
    8. Pseudomonas sp. EGD-AK9 Bacillaceae-1 RNA
    9. unclassified sequences Bacillaceae-1 RNA
    2D structure Publications