Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bacillus subtilis subsp. subtilis str. JH642 Bacillaceae-1 RNA secondary structure diagram

Bacillus subtilis subsp. subtilis str. JH642 Bacillaceae-1 RNA URS000065A032_535025

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAAAUGGAUCACAGGUUAAGUUCACCGCAUCCUGCGGCGACACCUGUGUGACCUGCGUCGUGCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bacillus sp. AtDRG31 Bacillaceae-1 RNA
  2. Bacillus sp. SJZ110 Bacillaceae-1 RNA
  3. Bacillus subtilis Bacillaceae-1 RNA
  4. Bacillus subtilis subsp. subtilis Bacillaceae-1
  5. Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 = DSM 10 Bacillaceae-1 RNA
  6. Bacillus subtilis subsp. subtilis str. 168 Bacillaceae-1 RNA
  7. Bacillus subtilis subsp. subtilis str. SMY Bacillaceae-1 RNA
  8. Pseudomonas sp. EGD-AK9 Bacillaceae-1 RNA
  9. unclassified sequences Bacillaceae-1 RNA
2D structure