Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Panthera tigris altaica (Amur tiger) tRNA secondary structure diagram

Panthera tigris altaica (Amur tiger) tRNA URS000063FB43_74533

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUGGGUGGUUCAGUGGUAGAAUUCUCGCCUGCCACGCGGGAGGCCCGGGUUCGAUUCCCGGCCCAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 101 other species

  1. Balaenoptera acutorostrata scammoni tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 5)
  2. Balaenoptera musculus (Blue whale) tRNA
  3. Bison bison bison (north american plains bison) tRNA
  4. Bos grunniens (domestic yak) tRNA
  5. Bos mutus Bos grunniens mutus tRNA
  6. Bos indicus tRNA
  7. Bos indicus x Bos taurus (hybrid cattle) tRNA
  8. Bos taurus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  9. Callithrix jacchus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  10. Callorhinus ursinus (northern fur seal) tRNA
  11. Camelus dromedarius (Arabian camel) tRNA
  12. Camelus ferus tRNA
  13. Canis lupus dingo (dingo) tRNA
  14. Canis lupus familiaris tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 37)
  15. Capra hircus (goat) tRNA
  16. Carlito syrichta tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 4)
  17. Castor canadensis (American beaver) tRNA
  18. Catagonus wagneri (Chacoan peccary) tRNA
  19. Cavia porcellus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2)
  20. Cercocebus atys (sooty mangabey) tRNA
  21. Chlorocebus sabaeus tRNA-Gly (GCC) (tRNA-Gly-GCC-4-1, tRNA-Gly-GCC-4-2)
  22. Colobus angolensis palliatus tRNA
  23. Cricetulus griseus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2)
  24. Dasypus novemcinctus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  25. Daubentonia madagascariensis tRNA-Gly
  26. Dipodomys ordii tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 4)
  27. Equus asinus (ass) tRNA
  28. Equus caballus (horse) tRNA
  29. Erinaceus europaeus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  30. Eschrichtius robustus (grey whale) tRNA
  31. Galemys pyrenaicus tRNA
  32. Gorilla gorilla gorilla tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-3)
  33. Gulo gulo (wolverine) tRNA
  34. Heterocephalus glaber tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  35. Hipposideros armiger tRNA
  36. Homo sapiens tRNA-Gly (anticodon GCC) 1-1 (TRG-GCC1 1 to 5)
  37. Inia geoffrensis tRNA-Gly
  38. Jaculus jaculus (lesser Egyptian jerboa) tRNA
  39. Loxodonta africana tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2)
  40. Lynx canadensis (Canada lynx) tRNA
  41. Macaca fascicularis (crab-eating macaque) tRNA
  42. Macaca mulatta tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  43. Macaca nemestrina (pig-tailed macaque) tRNA
  44. Marmota marmota marmota (Alpine marmot) tRNA
  45. Marmota monax (woodchuck) tRNA
  46. Microcebus murinus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2)
  47. Microtus ochrogaster (prairie vole) tRNA
  48. Molossus molossus (Pallas's mastiff bat) tRNA
  49. Neomonachus schauinslandi Monachus schauinslandi (Hawaiian monk seal) tRNA
  50. Monodelphis domestica tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 12)
  51. Moschus moschiferus (Siberian musk deer) tRNA
  52. Muntiacus reevesi (Chinese muntjac) tRNA
  53. Mus caroli tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  54. Mus musculus castaneus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  55. Mus musculus musculus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  56. Mus musculus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3, tRNA-Gly-GCC-2 1 to 3, tRNA-Gly-GCC-3 1 to 3)
  57. Mustela putorius furo (domestic ferret) tRNA
  58. Myotis brandtii tRNA
  59. Myotis davidii tRNA
  60. Myotis lucifugus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  61. Myotis myotis tRNA
  62. Nomascus leucogenys tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  63. Notamacropus eugenii tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  64. Nyctereutes procyonoides (raccoon dog) tRNA
  65. Ochotona princeps tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 6)
  66. Octodon degus (degu) tRNA
  67. Odocoileus virginianus texanus tRNA
  68. Onchocerca flexuosa tRNA
  69. Oryctolagus cuniculus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 7)
  70. Otolemur garnettii tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  71. Pan paniscus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2)
  72. Pan troglodytes tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  73. Papio anubis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  74. Patagioenas fasciata monilis tRNA
  75. Peromyscus maniculatus bairdii (prairie deer mouse) tRNA
  76. Peromyscus maniculatus sonoriensis tRNA-Gly
  77. Phascolarctos cinereus (koala) tRNA
  78. Phocoena sinus (vaquita) tRNA
  79. Phyllostomus discolor (pale spear-nosed bat) tRNA
  80. Piliocolobus tephrosceles (Ugandan red Colobus) tRNA
  81. Pipistrellus kuhlii (Kuhl's pipistrelle) tRNA
  82. Plecturocebus cupreus tRNA-OTHER
  83. Pongo abelii tRNA-Gly (GCC) (tRNA-Gly-GCC-1-3)
  84. Procavia capensis tRNA-Gly (GCC) (tRNA-Gly-GCC-3-1)
  85. Pteropus alecto (black flying fox) tRNA
  86. Pteropus vampyrus (large flying fox) tRNA
  87. Rattus norvegicus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 6)
  88. Rhinopithecus bieti (Black snub-nosed monkey) tRNA
  89. Saimiri boliviensis boliviensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  90. Sarcophilus harrisii tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 10)
  91. Sciurus vulgaris (Eurasian red squirrel) tRNA
  92. Sorex araneus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 4)
  93. Spermophilus dauricus (Daurian ground squirrel) tRNA
  94. Sus scrofa tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 7)
  95. Symphalangus syndactylus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  96. Theropithecus gelada (gelada baboon) tRNA
  97. Tupaia belangeri chinensis Tupaia chinensis (Chinese tree shrew) tRNA
  98. Tursiops truncatus (bottlenosed dolphin) tRNA
  99. Ursus maritimus (polar bear) tRNA
  100. Vicugna pacos tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  101. Vombatus ursinus (common wombat) tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications