Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-3) secondary structure diagram

Gorilla gorilla gorilla tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-3) URS000063FB43_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUGGGUGGUUCAGUGGUAGAAUUCUCGCCUGCCACGCGGGAGGCCCGGGUUCGAUUCCCGGCCCAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 46 other species

  1. Balaenoptera acutorostrata scammoni tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 5)
  2. Bos taurus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  3. Callithrix jacchus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  4. Camelus ferus tRNA
  5. Canis lupus familiaris tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  6. Carlito syrichta tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 4)
  7. Cavia porcellus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2)
  8. Chlorocebus sabaeus tRNA-Gly (GCC) (tRNA-Gly-GCC-4-1, tRNA-Gly-GCC-4-2)
  9. Cricetulus griseus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2)
  10. Dasypus novemcinctus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  11. Dipodomys ordii tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 4)
  12. Erinaceus europaeus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  13. Eschrichtius robustus tRNA-Gly
  14. Heterocephalus glaber tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  15. Homo sapiens tRNA-Gly (anticodon GCC) 1-1 (TRG-GCC1 1 to 5)
  16. Loxodonta africana tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2)
  17. Macaca mulatta tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  18. Marmota monax tRNA.Gly
  19. Microcebus murinus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2)
  20. Monodelphis domestica tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 12)
  21. Mus caroli tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  22. Mus musculus castaneus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  23. Mus musculus musculus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  24. Mus musculus tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3, tRNA-Gly-GCC-2 1 to 3, tRNA-Gly-GCC-3 1 to 3)
  25. Myotis brandtii tRNA
  26. Myotis davidii tRNA
  27. Myotis lucifugus tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  28. Nomascus leucogenys tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  29. Notamacropus eugenii tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  30. Ochotona princeps tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 6)
  31. Onchocerca flexuosa tRNA-Gly
  32. Oryctolagus cuniculus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 7)
  33. Otolemur garnettii tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 3)
  34. Pan troglodytes tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  35. Papio anubis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 5)
  36. Patagioenas fasciata monilis tRNA
  37. Pongo abelii tRNA-Gly (GCC) (tRNA-Gly-GCC-1-3)
  38. Procavia capensis tRNA-Gly (GCC) (tRNA-Gly-GCC-3-1)
  39. Pteropus alecto tRNA
  40. Rattus norvegicus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 6)
  41. Saimiri boliviensis boliviensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  42. Sarcophilus harrisii tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 10)
  43. Sorex araneus tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 4)
  44. Sus scrofa tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 7)
  45. Tupaia chinensis (Chinese tree shrew) tRNA
  46. Vicugna pacos tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
2D structure Publications