v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan troglodytes (chimpanzee) microRNA ptr-mir-1224 precursor secondary structure diagram

Pan troglodytes (chimpanzee) microRNA ptr-mir-1224 precursor URS00006378D3_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGAGGACUCGGGAGGUGGAGGGUGGUGCCGCCGGGGCCGGGCGCUGUUUCAGCUCGCUUCUCCCCCCACCUCCUCUCUCCUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla gorilla microRNA 1224 (ENSGGOG00000032805.2)
  2. Homo sapiens (human) microRNA hsa-mir-1224 precursor
  3. Pan paniscus microRNA 1224 (ENSPPAG00000009286.1)
 2D structure Publications