v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-708 precursor URS000062A2F0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR708: MIR708 is a microRNA that has been studied in various contexts [PMC6961682]. In a study, boxplot diagrams were used to analyze the expression levels of MIR708, and eight outliers were excluded from the data [PMC6961682]. Additionally, transfection of MIR708 mimics resulted in enhanced binding of MIR708 to Ago2, as shown in Figure 4D [PMC10067432]. Another finding from the study was that knockdown of circEZH2E2/E3 increased the binding of MIR708 to Ago2 [PMC10067432]. These results suggest that MIR708 plays a role in binding to Ago2 and may be involved in regulatory processes mediated by circEZH2E2/E3 [PMC10067432]. Further research is needed to fully understand the functional significance of MIR708 and its interactions with other molecules [PMC10067432].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AACUGCCCUCAAGGAGCUUACAAUCUAGCUGGGGGUAAAUGACUUGCACAUGAACACAACUAGACUGUGAGCUUCUAGAGGGCAGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Aotus nancymaae microRNA 708 (ENSANAG00000002662.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) mir-708 microRNA precursor family
  3. Carlito syrichta (Philippine tarsier) microRNA 708 (ENSTSYG00000031813.1)
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA 708 (ENSCCAG00000004385.1)
  5. Cercocebus atys (Sooty mangabey) microRNA 708 (ENSCATG00000009978.1)
  6. Chlorocebus sabaeus microRNA 708 (ENSCSAG00000026448.1)
  7. Colobus angolensis palliatus miRNA (ENSCANG00000007812.1)
  8. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 708 (ENSGGOG00000042824.1)
  9. Macaca mulatta (Rhesus monkey) microRNA mml-mir-708 precursor
  10. Macaca nemestrina microRNA 708 (ENSMNEG00000010624.1)
  11. Mandrillus leucophaeus (Drill) microRNA 708 (ENSMLEG00000004539.1)
  12. Nomascus leucogenys microRNA 708 (ENSNLEG00000021758.2)
  13. Otolemur garnettii microRNA 708 (ENSOGAG00000017458.1)
  14. Pan paniscus microRNA 708 (ENSPPAG00000007105.1)
  15. Pan troglodytes ptr-mir-708 (ENSPTRG00000032344.2)
  16. Papio anubis (Olive baboon) mir-708 microRNA precursor family
  17. Pongo abelii mir-708 microRNA precursor family
  18. Pongo pygmaeus microRNA ppy-mir-708 precursor
  19. Rhinopithecus roxellana microRNA 708 (ENSRROG00000028458.1)
  20. Saimiri boliviensis boliviensis microRNA 708 (ENSSBOG00000007012.1)
 Publications