v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca nemestrina (Pig-tailed macaque) microRNA 708 (ENSMNEG00000010624.1) URS000062A2F0_9545

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AACUGCCCUCAAGGAGCUUACAAUCUAGCUGGGGGUAAAUGACUUGCACAUGAACACAACUAGACUGUGAGCUUCUAGAGGGCAGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Aotus nancymaae microRNA 708 (ENSANAG00000002662.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) mir-708 microRNA precursor family
  3. Carlito syrichta (Philippine tarsier) microRNA 708 (ENSTSYG00000031813.1)
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA 708 (ENSCCAG00000004385.1)
  5. Cercocebus atys (Sooty mangabey) microRNA 708 (ENSCATG00000009978.1)
  6. Chlorocebus sabaeus microRNA 708 (ENSCSAG00000026448.1)
  7. Colobus angolensis palliatus miRNA (ENSCANG00000007812.1)
  8. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 708 (ENSGGOG00000042824.1)
  9. Homo sapiens (human) microRNA hsa-mir-708 precursor
  10. Macaca mulatta (Rhesus monkey) microRNA mml-mir-708 precursor
  11. Mandrillus leucophaeus (Drill) microRNA 708 (ENSMLEG00000004539.1)
  12. Nomascus leucogenys microRNA 708 (ENSNLEG00000021758.2)
  13. Otolemur garnettii microRNA 708 (ENSOGAG00000017458.1)
  14. Pan paniscus microRNA 708 (ENSPPAG00000007105.1)
  15. Pan troglodytes ptr-mir-708 (ENSPTRG00000032344.2)
  16. Papio anubis (Olive baboon) mir-708 microRNA precursor family
  17. Pongo abelii mir-708 microRNA precursor family
  18. Pongo pygmaeus microRNA ppy-mir-708 precursor
  19. Rhinopithecus roxellana microRNA 708 (ENSRROG00000028458.1)
  20. Saimiri boliviensis boliviensis microRNA 708 (ENSSBOG00000007012.1)
 Publications