v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Sarcophilus harrisii tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8) secondary structure diagram

Sarcophilus harrisii tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8) URS000061D582_9305

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUUCCGUAGUGUAGUGGUUAUCACGUUCGCCUAACACGCGAAAGGUCCCCGGUUCGAAACCGGGCGGAAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 92 other species

  1. Ailuropoda melanoleuca tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
  2. Alligator mississippiensis tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  3. Amazona aestiva tRNA-Val
  4. Ameiurus melas tRNA-Val
  5. Anguilla anguilla (European eel) tRNA-Val
  6. Anolis carolinensis tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  7. Apaloderma vittatum tRNA
  8. Ataeniobius toweri tRNA-Val
  9. Balaenoptera acutorostrata scammoni tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  10. Bos taurus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
  11. Callithrix jacchus tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 4)
  12. Callorhinchus milii tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
  13. Canis lupus familiaris tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  14. Carlito syrichta tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  15. Cavia porcellus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  16. Ceratotherium simum simum tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 6)
  17. Characodon lateralis tRNA-Val
  18. Chelydra serpentina tRNA-Val
  19. Chlorocebus sabaeus tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  20. Choloepus hoffmanni tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  21. Chrysemys picta bellii tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  22. Columba livia partial tRNA-Val
  23. Crenichthys baileyi tRNA-Val
  24. Cricetulus griseus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  25. Danionella translucida tRNA-Val
  26. Danio rerio tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  27. Dasypus novemcinctus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  28. Dipodomys ordii tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  29. Echinops telfairi tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  30. Eptesicus nilssonii tRNA-Val
  31. Equus caballus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
  32. Erinaceus europaeus tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 4)
  33. Felis catus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 6)
  34. Gallus gallus tRNA-Val (AAC) (tRNA-Val-AAC-2-1)
  35. Geospiza fortis tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
  36. Gorilla gorilla gorilla tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 4)
  37. Heterocephalus glaber tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  38. Homo sapiens tRNA-Val (anticodon AAC) 1-1 (TRV-AAC1 1 to 5)
  39. Ictidomys tridecemlineatus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  40. Lamprotornis superbus tRNA-OTHER
  41. Larimichthys crocea tRNA
  42. Latimeria chalumnae tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
  43. Loxodonta africana tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  44. Macaca mulatta tRNA-Val (AAC) (tRNA-Val-AAC-4-1, tRNA-Val-AAC-4-2, tRNA-Val-AAC-4-4)
  45. Marmota monax (woodchuck) tRNA.Val
  46. Meleagris gallopavo tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
  47. Melopsittacus undulatus tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  48. Microcebus murinus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 6)
  49. Monodelphis domestica tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
  50. Mus caroli tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  51. Mus musculus castaneus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  52. Mus musculus domesticus tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  53. Mus musculus musculus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  54. Mus musculus tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  55. Mus pahari tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  56. Mus spretus tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  57. Mustela putorius furo tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  58. Mycteria americana tRNA-OTHER
  59. Myotis lucifugus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  60. Nomascus leucogenys tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 5)
  61. Notamacropus eugenii tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  62. Nothobranchius furzeri tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  63. Ochotona princeps tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  64. Oreochromis niloticus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
  65. Ornithorhynchus anatinus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  66. Oryctolagus cuniculus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  67. Oryzias latipes tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  68. Otolemur garnettii tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  69. Ovis aries tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
  70. Pangasianodon gigas (Mekong giant catfish) tRNA-Val
  71. Pangasianodon hypophthalmus tRNA-Val
  72. Pangasius djambal tRNA-Val
  73. Pan troglodytes tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 7)
  74. Papio anubis tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 5)
  75. Pelobates cultripes tRNA.Val
  76. Perca fluviatilis (European perch) tRNA-Val
  77. Petromyzon marinus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 10)
  78. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  79. Podarcis lilfordi tRNA.Val
  80. Pongo abelii tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3, tRNA-Val-AAC-1-5, tRNA-Val-AAC-1-6)
  81. Procavia capensis tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  82. Rattus norvegicus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 4)
  83. Saimiri boliviensis boliviensis tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 3)
  84. Scleropages formosus (Asian bonytongue) tRNA-Val
  85. Sorex araneus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 6)
  86. Sphaerodactylus townsendi tRNA-Val
  87. Sus scrofa tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  88. Taeniopygia guttata tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 3)
  89. Takifugu rubripes tRNA-Val (AAC) (tRNA-Val-AAC-2-1)
  90. Trichechus manatus latirostris tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 4)
  91. Tursiops truncatus tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
  92. Vicugna pacos tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  93. Xenopus tropicalis tRNA-Val (AAC) (tRNA-Val-AAC-1-1)
 2D structure Publications