Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-1249 URS000060AABB_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-1249: Ssc-mir-1249 is a microRNA that has been identified in several studies [PMC9622794][PMC7490888][PMC7222767]. It is found to be shared among different groups in a Venn diagram analysis [PMC9622794]. In one study, ssc-mir-1249, along with ssc-miR-1307 and ssc-miR-1343, showed significant up-regulation in the LL group compared to the LH group [PMC7490888]. The high expression of lncRNAs TCONS_00429684 and TCONS_00309450 in the LH group may be promoted by the absorption of ssc-mir-1249, which could lead to increased GRIK4 transcription [PMC7490888]. However, the increased expression of ssc-mir-1249 in the LL group may inhibit GRIK4 transcription and negatively impact pig fertility [PMC7490888]. Ssc-mir-1249 is also found to be involved in regulatory networks with other miRNAs and circRNAs. It may directly target circRNAs to regulate their expression [PMC7222767]. In one study, ssc-mir-1249 was highly expressed in the LL group according to both RNA-seq and RT-qPCR results [PMC7222767]. CircRNA_010551 had multiple interactions with miRNAs including ssc-miR-1343, ssc-miR-652, ssc-mir-1249, and ssc-miR-1307 [PMC7222767]. CircRNA_006954 and circRNA_006665 contained binding sites for sccmimr 1249 and were downregulated in the LL group [PMC7222767]. Overall, these studies highlight the involvement of sccmimr 1249 in various regulatory networks and its potential impact on gene expression and fertility in pigs.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACGCCCUUCCCCCCCUUCUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-1249
  2. Canis lupus familiaris cfa-miR-1249
  3. Capra hircus (goat) chi-miR-1249
  4. Cervus elaphus cel-miR-1249
  5. Cricetulus griseus cgr-miR-1249
  6. Dasypus novemcinctus dno-miR-1249-3p
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1249_3p (mature (guide))
  8. Eptesicus fuscus efu-miR-1249
  9. Gorilla gorilla gorilla ggo-miR-1249 (MIR1249)
  10. Gorilla gorilla (western gorilla) ggo-miR-1249
  11. Homo sapiens (human) hsa-miR-1249-3p
  12. Macaca mulatta (Rhesus monkey) mml-miR-1249
  13. Mus musculus mmu-miR-1249-3p
  14. Oryctolagus cuniculus (rabbit) ocu-miR-1249-3p
  15. Pan troglodytes ptr-miR-1249
  16. Pongo pygmaeus (Bornean orangutan) ppy-miR-1249
  17. Rattus norvegicus rno-miR-1249
Publications