Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Eptesicus fuscus (big brown bat) efu-miR-1249 URS000060AABB_29078

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACGCCCUUCCCCCCCUUCUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-1249
  2. Canis lupus familiaris cfa-miR-1249
  3. Capra hircus (goat) chi-miR-1249
  4. Cervus elaphus cel-miR-1249
  5. Cricetulus griseus cgr-miR-1249
  6. Dasypus novemcinctus dno-miR-1249-3p
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1249_3p (mature (guide))
  8. Gorilla gorilla gorilla ggo-miR-1249 (MIR1249)
  9. Gorilla gorilla (western gorilla) ggo-miR-1249
  10. Homo sapiens (human) hsa-miR-1249-3p
  11. Macaca mulatta (Rhesus monkey) mml-miR-1249
  12. Mus musculus mmu-miR-1249-3p
  13. Oryctolagus cuniculus (rabbit) ocu-miR-1249-3p
  14. Pan troglodytes ptr-miR-1249
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-1249
  16. Rattus norvegicus rno-miR-1249
  17. Sus scrofa ssc-miR-1249
Publications