Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Takifugu rubripes (torafugu) fru-miR-101a URS00005FF45E_31033

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGUACUGUGAUAACUGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis (American alligator) ami-miR-101-3p
  2. Anolis carolinensis (green anole) Aca-Mir-101-P2-v1_3p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-101
  4. Bos taurus (cattle) Bta-Mir-101-P2-v1_3p (mature (guide))
  5. Callithrix jacchus cja-miR-101
  6. Canis lupus familiaris (dog) Cfa-Mir-101-P2-v1_3p (mature (guide))
  7. Cavia porcellus cpo-miR-101-3p
  8. Cervus elaphus cel-miR-101
  9. Chrysemys picta bellii Cpi-Mir-101-P2-v1_3p (mature (guide))
  10. Chrysemys picta cpi-miR-101-3p
  11. Columba livia (rock pigeon) Cli-Mir-101-P2-v1_3p (mature (guide))
  12. Cricetulus griseus (Chinese hamster) cgr-miR-101b-3p
  13. Cyprinus carpio (common carp) ccr-miR-101a
  14. Danio rerio (zebrafish) dre-miR-101a
  15. Dasypus novemcinctus dno-miR-101-3p
  16. Echinops telfairi Ete-Mir-101-P2-v1_3p (mature (guide))
  17. Gallus gallus Gga-Mir-101-P2-v1_3p (mature (guide))
  18. Gekko japonicus Gja-Mir-101-P2-v1_3p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-101 (MIR101)
  20. Gorilla gorilla (western gorilla) ggo-miR-101
  21. Haplochromis burtoni abu-miR-101a
  22. Homo sapiens Hsa-Mir-101-P2-v1_3p (mature (guide))
  23. Ictalurus punctatus ipu-miR-101a
  24. Lagothrix lagotricha lla-miR-101
  25. Latimeria chalumnae (coelacanth) Lch-Mir-101-P2_3p (mature (guide))
  26. Lepisosteus oculatus Loc-Mir-101-P1-v1_3p (mature (guide))
  27. Macaca mulatta mml-miR-101-3p
  28. Macaca nemestrina (pig-tailed macaque) mne-miR-101
  29. Maylandia zebra (zebra mbuna) mze-miR-101a
  30. Microcaecilia unicolor Mun-Mir-101-P2-v1_3p (mature (guide))
  31. Monodelphis domestica mdo-miR-101-3p
  32. Monopterus albus Mal-Mir-101-P1-v1_3p (mature (guide))
  33. Mus musculus Mmu-Mir-101-P1-v1_3p (mature (guide))
  34. Neolamprologus brichardi (lyretail cichlid) nbr-miR-101a
  35. Ophiophagus hannah (king cobra) oha-miR-101b-3p
  36. Oreochromis niloticus oni-miR-101a
  37. Ornithorhynchus anatinus oan-miR-101
  38. Oryctolagus cuniculus ocu-miR-101-3p
  39. Pan paniscus ppa-miR-101
  40. Pan troglodytes ptr-miR-101
  41. Pongo pygmaeus microRNA mir-101-1
  42. Pundamilia nyererei pny-miR-101a
  43. Python bivittatus (Burmese python) pbv-miR-101-3p
  44. Rattus norvegicus (Norway rat) Rno-Mir-101-P1-v1_3p (mature (guide))
  45. Saguinus labiatus (red-chested mustached tamarin) sla-miR-101
  46. Salmo salar (Atlantic salmon) ssa-miR-101a-3p
  47. Sarcophilus harrisii Sha-Mir-101-P2-v1_3p (mature (guide))
  48. Scyliorhinus torazame (cloudy catshark) Sto-Mir-101-P2-v1_3p (mature (guide))
  49. Sphenodon punctatus (tuatara) Spt-Mir-101-P2_3p (mature (guide))
  50. Taeniopygia guttata (zebra finch) Tgu-Mir-101-P2-v1_3p (mature (guide))
  51. Tetraodon nigroviridis tni-miR-101a
  52. Tor tambroides (Thai mahseer) miR-101a
  53. Xenopus laevis xla-miR-101-3p
  54. Xenopus tropicalis (tropical clawed frog) xtr-miR-101a
Publications