Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4651 URS00005F9738_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4651: Hsa-mir-4651 is a microRNA that has been implicated in various biological processes and diseases. It has been predicted to target several genes in different contexts. In gestational diabetes mellitus (GDM), hsa-mir-4651 was found to target the gene FYN [PMC8145272]. In Alport syndrome, hsa-mir-4651 was found to be upregulated in iPSCs from patients [PMC7998154]. In liver fibrosis, hsa-mir-4651 was identified as one of the upregulated miRNAs [PMC5039723]. In non-small-cell lung cancer, hsa-mir-4651 was found to inhibit cancer progression by targeting BRD4 [PMC7347495]. Additionally, hsa-mir-4651 has been implicated in HIV infection and HIV-associated diseases [PMC4865051]. It is worth noting that hsa-mir-4651 is not the only miRNA of interest in these contexts, as several other miRNAs have also been identified as potential regulators of gene expression. These findings highlight the complexity and diversity of miRNA-mediated gene regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGGUGGGUGAGGUCGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications