Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4510 URS00005F1B8C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4510: Hsa-mir-4510 is a microRNA that has been identified in various studies. It is one of the co-targeting miRNAs in a study that identified 43 miRNAs, including hsa-mir-4510, that potentially play a role in certain conditions [PMC7607069]. In patients with NTG (normal tension glaucoma), hsa-mir-4510 was found to be significantly upregulated compared to controls [PMC9007941]. Additionally, hsa-mir-4510 has been predicted to target the SARS-CoV-2 genome, suggesting its potential involvement in COVID-19 disease [PMC8890551]. In another study, hsa-mir-4510 was identified as one of the miRNAs associated with 90-day mortality prediction [PMC8890551]. Furthermore, hsa-mir-4510 was found to be downregulated with a specific genotype of rs2736118 and dysregulated between adenomatous and carcinoma tissue [PMC5023115]. It was also included as one of the predictors in a random forest model for certain conditions [PMC7918779]. In terms of its biological role, hsa-mir-4510 has been associated with various targets and pathways related to different diseases such as breast cancer and head and neck squamous cell carcinoma (HNSCC) [PMC5779952] [PMC9908886] [PMC7500352]. Overall, these studies highlight the potential significance of hsa-mir-4510 in different diseases and conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGGAGUAGGAUGUAUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications