Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens let-7a-1 stem-loop (hsa-let-7a-1) URS00005EB5B7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIRLET7A1: MIRLET7A1 is a microRNA gene located on chromosome 9q22.3 [PMC5356719]. It is one of the three genes expressing let-7a, along with MIRLET7A2 on 11q24.1 and MIRLET7A3 on 22q13.3 [PMC5356719]. MIRLET7A1 has been studied in the context of adenoviral shuttle vectors and priMIR expression vectors [PMC6923634]. It is targeted by several miRNAs, including members of the let-7 family, suggesting potential auto-regulation [PMC7961530]. MIRLET7A1 has also been included in targeted capture assays for detecting structural variations and copy number analysis [PMC7815088]. In the context of acute lymphoblastic leukemia (ALL), variants in MIRLET7A1 have been associated with severe hematologic toxicity arising from treatment [PMC10003057]. Specifically, variants rs12904 (MIR200C), rs3746444 (MIR499A), and rs10739971 (MIRLET7A1) have shown significant associations with hematologic toxicity in ALL patients [PMC10003057]. Furthermore, the rs10739971 variant of MIRLET7A1 has been associated with a potential protective factor against toxic hematological events in pediatric patients undergoing ALL treatment [PMC10003057]. However, no significant differences have been found for genotype and allele frequencies of several miRNAs including MIRLET7A1 between cases and controls in a specific population studied for breast cancer susceptibility [PMC4650490]. Chromosomal loss at 9q22 has also led to recurrent loss of the MIRLET7A gene family, including MIRLET7A1 [PMC7459851]. Overall, studies suggest that MIRLET7A1 plays regulatory roles in cellular processes and may have implications in cancer and therapeutic response [PMC8840188] [PMC10003057] [PMC7459851].

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Aotus nancymaae miRNA (ENSANAG00000002894.1)
  2. Ateles geoffroyi (black-handed spider monkey) precursor microRNA let-7a-1
  3. Bos taurus let-7a-1 stem-loop (bta-let-7a-1)
  4. Capra hircus (Goat) microRNA let-7a-1 (ENSCHIG00000009519.1)
  5. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000021072.2)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA let-7a-1 (ENSCCAG00000005244.1)
  7. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000010054.1)
  8. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000008020.1)
  9. Echinops telfairi (small Madagascar hedgehog) miRNA (ENSETEG00000021920.1)
  10. Gorilla gorilla gorilla microRNA let-7a-1 (ENSGGOG00000030966.2)
  11. Gorilla gorilla precursor microRNA let-7a-1
  12. Lagothrix lagotricha (brown woolly monkey) precursor microRNA let-7a-1
  13. Lemur catta precursor microRNA let-7a-1
  14. Macaca mulatta let-7a-1 stem-loop (mml-let-7a-1)
  15. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000010971.1)
  16. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000004753.1)
  17. Microcebus murinus microRNA let-7a-1 (ENSMICG00000019650.3)
  18. Myotis lucifugus (little brown bat) miRNA (ENSMLUG00000018054.1)
  19. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA (ENSNLEG00000027736.1, ENSNLEG00000034490.1)
  20. Oryctolagus cuniculus (rabbit) ocu-let-7a-1 (ENSOCUG00000018323.1)
  21. Pan paniscus microRNA let-7a-1 (ENSPPAG00000007576.1)
  22. Panthera pardus microRNA let-7a-1 (ENSPPRG00000013995.1)
  23. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002647.1)
  24. Pan troglodytes ptr-let-7a-1 (ENSPTRG00000027844.4)
  25. Pongo abelii (Sumatran orangutan) miRNA
  26. Pongo pygmaeus let-7a-1 stem-loop (ppy-let-7a-1)
  27. Propithecus coquereli miRNA (ENSPCOG00000011738.1)
  28. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000025480.1)
  29. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000007863.1)
  30. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000024057.1)
  31. Saguinus labiatus precursor microRNA let-7a-1
  32. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000019121.1)
  33. Sorex araneus (European shrew) miRNA (ENSSARG00000016564.1)
  34. Suricata suricatta (meerkat) microRNA let-7a-1 (ENSSSUG00005021949.1)
  35. Tursiops truncatus miRNA (ENSTTRG00000022643.1)
  36. Vicugna pacos miRNA (ENSVPAG00000016957.1)
Publications