Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila persimilis dpe-miR-316 URS00005CD5FC_7234

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCUUUUUCCGCUUACUGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Cochliomyia hominivorax mature cho-miR-316
  2. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-316
  3. Drosophila ananassae dan-miR-316
  4. Drosophila erecta der-miR-316
  5. Drosophila grimshawi dgr-miR-316
  6. Drosophila melanogaster (fruit fly) dme-miR-316-5p
  7. Drosophila pseudoobscura dps-miR-316
  8. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294507_df_nrg
  9. Drosophila sechellia dse-miR-316
  10. Drosophila simulans dsi-miR-316
  11. Drosophila willistoni dwi-miR-316
  12. Drosophila yakuba dya-miR-316
  13. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-10896396