Drosophila melanogaster (fruit fly) dme-miR-316-5p URS00005CD5FC_7227

• 22 nucleotides
• 6 databases (ENA, FlyBase, miRBase, MirGeneDB, PirBase, RefSeq)
• Found in 13 other species
• 42 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGUCUUUUUCCGCUUACUGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

1. Cochliomyia hominivorax mature cho-miR-316
2. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-316
3. Drosophila ananassae dan-miR-316
4. Drosophila erecta der-miR-316
5. Drosophila grimshawi dgr-miR-316
6. Drosophila persimilis dpe-miR-316
7. Drosophila pseudoobscura dps-miR-316
8. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294507_df_nrg
9. Drosophila sechellia dse-miR-316
10. Drosophila simulans dsi-miR-316
11. Drosophila willistoni dwi-miR-316
12. Drosophila yakuba dya-miR-316
13. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-10896396

Publications Download

• FASTA
• JSON