Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-504-5p URS00005CC20C_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGACCCUGGUCUGCACUCUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Canis lupus familiaris cfa-miR-504
  2. Cavia porcellus cpo-miR-504-5p
  3. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-504-v1_5p (mature (guide))
  4. Equus caballus eca-miR-504
  5. Homo sapiens (human) hsa-miR-504-5p
  6. Macaca mulatta (Rhesus monkey) mml-miR-504-5p
  7. Mus musculus (house mouse) mmu-miR-504-5p
  8. Pan troglodytes ptr-miR-504
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-504
  10. Tupaia chinensis (Chinese tree shrew) tch-miR-504
Publications