Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-504-5p URS00005CC20C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-504: Hsa-mir-504 is a known pre-miRNA that has been experimentally verified and is listed in miRBase V19 [PMC4670854]. It has been found to be expressed at lower levels than miR-1231 in microarray analysis [PMC6132976]. Hsa-mir-504 has been shown to be involved in the regulation of apoptosis through its coordination with hsa-miR-125a and the regulation of BAK1 and BCL2 genes [PMC4363532]. It has also been discovered that hsa-mir-504 is closely related to prostate cancer [PMC8024646]. Additionally, hsa-mir-504 has been found to function as a tumor suppressor in gastric cancer by acting as a sponge for hsa_circ_0005699, which downregulates MCM8 and NCAPD2 expression [PMC7859334]. Hsa-mir-504 is part of a circRNA-miRNA-hub_gene network that includes other miRNAs such as hsa-miR-22, hsa-miR-328, and hsa-miR-1306 [PMC6857072]. It has also been shown that the expression of hsa-mir-504 is regulated by progesterone support in luteal phase [PMC3462109]. Hsa-mir-504 is involved in the regulation of ribosome biogenesis through its interaction with FGF13 1A and TP53 genes, promoting cell survival in models of oncogenic escape [PMC7200637]. Furthermore, it has been used as a probe for miRNA detection along with other miRNAs such as hsa -miR 142 and hsa -miR 335 [PMC4699463].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGACCCUGGUCUGCACUCUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Canis lupus familiaris cfa-miR-504
  2. Cavia porcellus cpo-miR-504-5p
  3. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-504-v1_5p (mature (guide))
  4. Equus caballus eca-miR-504
  5. Macaca mulatta (Rhesus monkey) mml-miR-504-5p
  6. Mus musculus (house mouse) mmu-miR-504-5p
  7. Oryctolagus cuniculus ocu-miR-504-5p
  8. Pan troglodytes ptr-miR-504
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-504
  10. Tupaia chinensis (Chinese tree shrew) tch-miR-504
Publications