v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhagoletis pomonella (Apple magot fly) tRNA-Gly secondary structure diagram

Rhagoletis pomonella (Apple magot fly) tRNA-Gly URS00005BE1FC_28610

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAUCGGUGGUUCAGUGGUAGAAUGCUCGCCUGCCACGCGGGCGGCCUGGGUUCGAUUCCCGGCCGAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Blattella germanica tRNA-Gly (GCC) (tRNA-Gly-GCC-3-1)
  2. Cordylochernes scorpioides tRNA-Gly
  3. Drosophila melanogaster transfer RNA:Glycine-GCC 2-1 (Dmel_CR31980)
  4. Drosophila sechellia tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  5. Heliconius melpomene tRNA HMEL016522
  6. Nippostrongylus brasiliensis tRNA
  7. Schistocerca cancellata (South American locust) transfer RNA glycine (anticodon GCC)
  8. Schistocerca gregaria (Grasshoppers) transfer RNA glycine (anticodon GCC)
  9. Schistocerca serialis cubense (Grasshoppers) transfer RNA glycine (anticodon GCC)
 2D structure