Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Schistocerca serialis cubense (Grasshoppers) transfer RNA glycine (anticodon GCC) secondary structure diagram

Schistocerca serialis cubense (Grasshoppers) transfer RNA glycine (anticodon GCC) URS00005BE1FC_2023355

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUCGGUGGUUCAGUGGUAGAAUGCUCGCCUGCCACGCGGGCGGCCUGGGUUCGAUUCCCGGCCGAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Blattella germanica tRNA-Gly (GCC) (tRNA-Gly-GCC-3-1)
  2. Cordylochernes scorpioides tRNA-Gly
  3. Ctenocephalides felis (Cat flea) tRNA-Gly
  4. Drosophila melanogaster transfer RNA:Glycine-GCC 2-1 (Dmel_CR31980)
  5. Drosophila sechellia tRNA-Gly (GCC) (tRNA-Gly-GCC-2-1)
  6. Heliconius melpomene (Postman butterfly) tRNA HMEL016522
  7. Nippostrongylus brasiliensis tRNA
  8. Rhagoletis pomonella tRNA-Gly
  9. Schistocerca cancellata (South American locust) transfer RNA glycine (anticodon GCC)
  10. Schistocerca gregaria (Grasshoppers) transfer RNA glycine (anticodon GCC)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...