Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila ficusphila (Fruit fly) tRNA-Asp secondary structure diagram

Drosophila ficusphila (Fruit fly) tRNA-Asp URS00005B5FDD_30025

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUCGAUAGUAUAGUGGUUAGUAUCCCCGCCUGUCACGCGGGAGACCGGGGUUCAAUUCCCCGUCGGGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Anastrepha ludens (Mexican fruit fly) transfer RNA aspartic acid (anticodon GUC)
  2. Anastrepha obliqua (WestIndian fruit fly) transfer RNA aspartic acid (anticodon GUC)
  3. Bactrocera dorsalis tRNA-Asp
  4. Bactrocera latifrons tRNA-Asp
  5. Ceratitis capitata (Mediterranean fruit fly) tRNA-Asp
  6. Drosophila albomicans (Fruit fly) transfer RNA aspartic acid (anticodon GUC)
  7. Drosophila ananassae tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 13)
  8. Drosophila arizonae (Fruit fly) tRNA-Asp
  9. Drosophila biarmipes (Fruit fly) transfer RNA aspartic acid (anticodon GUC)
  10. Drosophila bipectinata (Fruit fly) tRNA-Asp
  11. Drosophila busckii (Fruit fly) tRNA-Asp
  12. Drosophila elegans (Fruit fly) tRNA-Asp
  13. Drosophila erecta tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 13)
  14. Drosophila eugracilis (Fruit fly) tRNA-Asp
  15. Drosophila grimshawi tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 12)
  16. Drosophila gunungcola (Fruit fly) transfer RNA aspartic acid (anticodon GUC)
  17. Drosophila hydei (Fruit fly) tRNA-Asp
  18. Drosophila innubila (Fruit fly) tRNA-Asp
  19. Drosophila kikkawai (Fruit fly) tRNA-Asp
  20. Drosophila mauritiana (Fruit fly) tRNA-Asp
  21. Drosophila melanogaster transfer RNA:Aspartic acid-GTC 1-12 (multiple genes)
  22. Drosophila miranda (Fruit fly) tRNA-Asp
  23. Drosophila mojavensis tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 10)
  24. Drosophila navojoa (Fruit fly) tRNA-Asp
  25. Drosophila persimilis tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1, tRNA-Asp-GTC-1-2)
  26. Drosophila pseudoobscura (Fruit fly) tRNA-Asp
  27. Drosophila pseudoobscura pseudoobscura tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1, tRNA-Asp-GTC-1-2)
  28. Drosophila rhopaloa (Fruit fly) tRNA-Asp
  29. Drosophila santomea (Fruit fly) tRNA-Asp
  30. Drosophila sechellia tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 11)
  31. Drosophila simulans tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 11)
  32. Drosophila subpulchrella (Fruit fly) tRNA-Asp
  33. Drosophila suzukii (Fruit fly) tRNA-Asp
  34. Drosophila takahashii (Fruit fly) tRNA-Asp
  35. Drosophila teissieri (Fruit fly) tRNA-Asp
  36. Drosophila virilis tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 12)
  37. Drosophila willistoni tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 12)
  38. Drosophila yakuba tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 14)
  39. Glossina austeni tRNA tRNA-Asp
  40. Glossina brevipalpis tRNA tRNA-Asp
  41. Glossina fuscipes fuscipes tRNA
  42. Glossina morsitans morsitans tRNA tRNA-Asp
  43. Glossina pallidipes tRNA tRNA-Asp
  44. Glossina palpalis gambiensis tRNA tRNA-Asp
  45. Lucilia cuprina (Australian sheep blowfly) tRNA-Asp for anticodon GUC
  46. Musca domestica tRNA MDOA013274
  47. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005012973.1
  48. Oppiella nova tRNA
  49. Petromyzon marinus tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 34)
  50. Priapulus caudatus (Penis worm) tRNA-Asp
  51. Rhagoletis pomonella tRNA-Asp
  52. Scaptodrosophila lebanonensis tRNA
  53. Stomoxys calcitrans (Stable fly) tRNA-Asp
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications