Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Glossina fuscipes fuscipes tRNA secondary structure diagram

Glossina fuscipes fuscipes tRNA URS00005B5FDD_201502

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUCGAUAGUAUAGUGGUUAGUAUCCCCGCCUGUCACGCGGGAGACCGGGGUUCAAUUCCCCGUCGGGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Bactrocera dorsalis tRNA-Asp
  2. Bactrocera latifrons (Solanum fruit fly) tRNA-Asp
  3. Ceratitis capitata (Mediterranean fruit fly) tRNA-Asp
  4. Drosophila ananassae tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 13)
  5. Drosophila busckii tRNA
  6. Drosophila erecta tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 13)
  7. Drosophila ficusphila tRNA
  8. Drosophila grimshawi tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 12)
  9. Drosophila gunungcola tRNA-OTHER
  10. Drosophila melanogaster transfer RNA:Aspartic acid-GTC 1-12 (multiple genes)
  11. Drosophila mojavensis tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 10)
  12. Drosophila persimilis tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1, tRNA-Asp-GTC-1-2)
  13. Drosophila pseudoobscura pseudoobscura tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1, tRNA-Asp-GTC-1-2)
  14. Drosophila sechellia tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 11)
  15. Drosophila simulans tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 11)
  16. Drosophila virilis tRNA-Asp (GTC) (tRNA-Asp-GTC-2 1 to 12)
  17. Drosophila willistoni tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 12)
  18. Drosophila yakuba tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 14)
  19. Glossina austeni tRNA tRNA-Asp
  20. Glossina brevipalpis tRNA tRNA-Asp
  21. Glossina morsitans morsitans tRNA tRNA-Asp
  22. Glossina pallidipes tRNA tRNA-Asp
  23. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Asp
  24. Lucilia cuprina tRNA-Asp for anticodon GUC
  25. Musca domestica tRNA MDOA013274
  26. Petromyzon marinus tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 34)
  27. Priapulus caudatus tRNA-Asp
  28. Rhagoletis pomonella tRNA-Asp
  29. Stomoxys calcitrans tRNA-Asp
2D structure Publications