Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-23b-5p URS00005B5CA1_10090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Mus musculus. Annotated by 5 databases (miRBase, RefSeq, MirGeneDB, ENA, PirBase). Described in 34 papers. Mus musculus (house mouse) mmu-miR-23b-5p sequence is a product of mmu-miR-23b, mmu-miR-23b-5p, miR-23b-5p, miR-23b, miR-23, Mir23b genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGGUUCCUGGCAUGCUGAUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Alligator mississippiensis ami-miR-23b-5p
    2. Anolis carolinensis (green anole) aca-miR-23b-5p
    3. Bos taurus (cattle) bta-miR-23b-5p
    4. Canis lupus familiaris (dog) Cfa-Mir-23-P2_5p* (star (passenger))
    5. Cavia porcellus cpo-miR-23b-5p
    6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-23-P2_5p* (star (passenger))
    7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-23b-5p
    8. Echinops telfairi Ete-Mir-23-P2_5p* (star (passenger))
    9. Macaca mulatta (Rhesus monkey) mml-miR-23b-5p
    10. Monodelphis domestica mdo-miR-23b-5p
    11. Oryctolagus cuniculus (rabbit) ocu-miR-23b-5p
    12. Pteropus alecto pal-miR-23b-5p
    13. Python bivittatus (Burmese python) pbv-miR-23b-5p
    14. Rattus norvegicus rno-miR-23b-5p
    15. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-23-P2_5p* (star (passenger))