Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-125a-5p URS00005A4DCF_9606

Automated summary: This miRNA sequence is 24 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (TarBase, IntAct, MirGeneDB, GeneCards, RefSeq, LncBase, miRBase, ENA, PSICQUIC, MalaCards). Described in 86 papers. Homo sapiens (human) hsa-miR-125a-5p sequence is a product of hsa-miR-125a-5p, miR-125, hsa-miR-125a, miR-125a, MIR125A, miR-125a-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 14-3-3GAMMA, 14-3-3γ, 16.3A5, 2PP2A, 30K, 3D3, 4F2, 4F2HC, 4T2HC.

Interactions 18

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-125a-5p interacts with:

Interaction id Participant Synonyms
EBI-22052482 intact:EBI-21019594 EBI-21019594 ENST00000405375 mrna_cdkn1a
EBI-26353019 intact:EBI-26353086 EBI-26353086 ENSG00000132155 ENST00000251849 mrna_raf1
URS00005A4DCF_9606-9 O14733 O14733
URS00005A4DCF_9606-0 O14733 O14733
URS00005A4DCF_9606-1 P01579 P01579
URS00005A4DCF_9606-11 P08887 P08887
URS00005A4DCF_9606-3 P08887 P08887
URS00005A4DCF_9606-2 P08887 P08887
URS00005A4DCF_9606-10 P08887 P08887
URS00005A4DCF_9606-4 P15692 P15692
URS00005A4DCF_9606-12 P38936 P38936
URS00005A4DCF_9606-5 P38936 P38936
URS00005A4DCF_9606-6 P40763 P40763
URS00005A4DCF_9606-13 P40763 P40763
URS00005A4DCF_9606-14 Q14005 Q14005
URS00005A4DCF_9606-7 Q14005 Q14005
URS00005A4DCF_9606-8 Q9NR61 Q9NR61
URS00005A4DCF_9606-15 Q9NR61 Q9NR61

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCCUGAGACCCUUUAACCUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 26 other species

    1. Bos taurus (cattle) Bta-Mir-10-P3b_5p (mature (guide))
    2. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-1304734
    3. Canis lupus familiaris (dog) Cfa-Mir-10-P3b_5p (mature (guide))
    4. Cavia porcellus cpo-miR-125a-5p
    5. Cervus elaphus (red deer) cel-miR-125a
    6. Cricetulus griseus (Chinese hamster) cgr-miR-125a-5p
    7. Drosophila erecta Drosophila_erecta piRNA piR-der-612273
    8. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-21274037
    9. Echinops telfairi Ete-Mir-10-P3b_5p (mature (guide))
    10. Equus caballus eca-miR-125a-5p
    11. Macaca mulatta mml-miR-125a-5p
    12. Mus musculus mmu-miR-125a-5p
    13. Oryctolagus cuniculus Ocu-Mir-10-P3b_5p (mature (guide))
    14. Otolemur garnettii oga-miR-125a
    15. Pongo pygmaeus ppy-miR-125a-5p
    16. Rattus norvegicus rno-miR-125a-5p
    17. Saimiri boliviensis boliviensis sbo-miR-125a