v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-125a-5p URS00005A4DCF_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCCUGAGACCCUUUAACCUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus (cattle) Bta-Mir-10-P3b_5p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-1304734
  3. Canis lupus familiaris (dog) Cfa-Mir-10-P3b_5p (mature (guide))
  4. Cavia porcellus (domestic guinea pig) cpo-miR-125a-5p
  5. Cervus elaphus (red deer) cel-miR-125a
  6. Cricetulus griseus (Chinese hamster) cgr-miR-125a-5p
  7. Drosophila erecta Drosophila_erecta piRNA piR-der-612273
  8. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21274037
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P3b_5p (mature (guide))
  10. Equus caballus eca-miR-125a-5p
  11. Homo sapiens (human) hsa-miR-125a-5p
  12. Mus musculus (house mouse) mmu-miR-125a-5p
  13. Oryctolagus cuniculus Ocu-Mir-10-P3b_5p (mature (guide))
  14. Otolemur garnettii (small-eared galago) oga-miR-125a
  15. Pongo pygmaeus ppy-miR-125a-5p
  16. Rattus norvegicus (Norway rat) rno-miR-125a-5p
  17. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-125a
 Publications