Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus laevis (African clawed frog) xla-miR-204* URS000059A01D_8355

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGGGAAGGCAAAGGGACGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Alligator mississippiensis ami-miR-204-3p
  2. Anolis carolinensis aca-miR-204a-3p
  3. Cavia porcellus cpo-miR-204-3p
  4. Chrysemys picta (Painted turtle) cpi-miR-204-3p
  5. Columba livia (rock pigeon) cli-miR-204-3p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-204-3p
  7. Homo sapiens hsa-miR-204-3p
  8. Mus musculus mmu-miR-204-3p
  9. Ophiophagus hannah (king cobra) oha-miR-204-1-3p
  10. Oryctolagus cuniculus ocu-miR-204-3p
  11. Pteropus alecto (black flying fox) pal-miR-204-3p
  12. Sarcophilus harrisii (Tasmanian devil) sha-miR-204