Mus musculus (house mouse) mmu-miR-204-3p URS000059A01D_10090

• 21 nucleotides
• 4 databases (ENA, miRBase, PirBase, RefSeq)
• Found in 12 other species
• 2927 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. piRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

GCUGGGAAGGCAAAGGGACGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Alligator mississippiensis ami-miR-204-3p
2. Anolis carolinensis aca-miR-204a-3p
3. Cavia porcellus cpo-miR-204-3p
4. Chrysemys picta (Painted turtle) cpi-miR-204-3p
5. Columba livia (rock pigeon) cli-miR-204-3p
6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-204-3p
7. Homo sapiens hsa-miR-204-3p
8. Ophiophagus hannah (king cobra) oha-miR-204-1-3p
9. Oryctolagus cuniculus ocu-miR-204-3p
10. Pteropus alecto (black flying fox) pal-miR-204-3p
11. Sarcophilus harrisii (Tasmanian devil) sha-miR-204
12. Xenopus laevis (African clawed frog) xla-miR-204*

Publications Download

• FASTA
• JSON