Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-484 URS0000597BED_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-484: Bta-mir-484 is a miRNA that has been found to have various roles and associations in different biological processes. It has been identified to have a complementary site in the 3'UTR of the STAT5 mRNA and is also paired with the 3'UTR of the HK2 mRNA with five other miRNAs [PMC3551688]. Bta-mir-484 has been observed to have a negative correlation with QDPR, LY6E, and DOLPP1 genes, as well as a positive correlation with C16:0 concentrations in milk [PMC6164576]. It functions as a tumor suppressor and may serve as a prospective biomarker for cervical cancer by targeting ZEB1 and SMAD2 genes [PMC6164576]. Bta-mir-484 is also important in the regulation of lactation signaling [PMC6164576]. In Chinese Holstein cattle, a SNP in bta-mir-484 disrupted miRNA binding, leading to increased expression of the target gene heat-shock transcription factor 1 [PMC3478155]. Bta-mir-484 has been experimentally verified as a miRNA gene in bovine [PMC2254598]. It is predicted to target CASP3 gene, which is associated with inflammatory response [PMC8433134]. Several sub-networks involving bta-mir-484 have been identified as potential pathways/genes that may contribute to bovine endometritis progression and could be regarded as biomarkers and therapeutic targets for this infection [PMC8433134]. The SNP G4693T affects HSF1 gene expression by influencing the binding of HSF1 to bta-mir-484 [PMC9659462]. Mutations in bta-mir-484 seed sequence neo-SNPs (G4693T) directly lead to increased expression of HSF1 while affecting heat stress resistance response in cows [PMC8959652].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGGCUCAGUCCCCUCCCGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Cricetulus griseus cgr-miR-484
  2. Homo sapiens hsa-miR-484
  3. Macaca mulatta mml-miR-484
  4. Mus musculus mmu-miR-484
  5. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-484
  6. Pan paniscus ppa-miR-484
  7. Pan troglodytes ptr-miR-484
  8. Pongo pygmaeus ppy-miR-484
  9. Rattus norvegicus rno-miR-484
Publications