Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-484 URS0000597BED_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-484: Mmu-mir-484 is a microRNA that has been found to show a significant negative correlation with the mRNA that encodes Map2k4 and Pik3r1 [PMC8430919]. It is among the miRNAs that regulate selected mRNAs, along with mmu-let-7b-5p, mmu-let-7c-5p, mmu-let-7d-5p, mmu-miR-129-3p, mmu-miR23a3p, mmu-miR6725p, and mmu-miR6763p [PMC8430919]. The expression of mmu-mir484 is upregulated in the prefrontal cortical regions of mice upon stress [PMC8430919]. It has also been associated with changes in cognitive, motor, and emotional behavior in mice [PMC8959652]. Aberrant expression of mmu-mir484 has been observed in Alzheimer's disease model mice [PMC8959652]. Imbalance in the expression of mature mmumir484 and protocadherin19 affects neurogenesis [PMC8959652]. Cerebral ischemia/reperfusion injury in mice leads to a downregulation of mmumir484 expression [PMC8959652]. Mmu-mir484 is involved in stress resilience through the regulation of Map2k4 and Pik3r1in prefrontal cortical regions [PMC8959652]. It has also been found to induce tumorigenesis through pro-inflammation pathways [PMC8959652]. Mmu-mir484 has been shown to be upregulated in exosomes compared to parent cells MIN6 cells [PMC7695333]. It is also predicted to interact with several other miRNAs including miR2063p, miR1a3p, miR5983p, miR1473p, miR34a5p, and miR21a3p [PMC6958735]. The potential function of mmu-mir484 has been explored along with other miRNAs in brain development [PMC5792815]. It has been identified as one of the upstream miRNA repressors inhibiting the translation of Oct4 [PMC3198445].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGGCUCAGUCCCCUCCCGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bos taurus bta-miR-484
  2. Cricetulus griseus cgr-miR-484
  3. Homo sapiens hsa-miR-484
  4. Macaca mulatta mml-miR-484
  5. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-484
  6. Pan paniscus ppa-miR-484
  7. Pan troglodytes ptr-miR-484
  8. Pongo pygmaeus ppy-miR-484
  9. Rattus norvegicus rno-miR-484
Publications