v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Arabidopsis thaliana x Arabidopsis arenosa tRNA-Glu secondary structure diagram

Arabidopsis thaliana x Arabidopsis arenosa tRNA-Glu URS0000591E4F_1240361

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCGAUGUCGUCCAGCGGUUAGGAUAUCUGGCUUUCACCCAGGAGACCCGGGUUCGAUUCCCGGCAUCGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Arabidopsis halleri subsp. gemmifera tRNA-Glu for anticodon UUC
  2. Arabidopsis lyrata subsp. lyrata tRNA-Glu for anticodon UUC
  3. Arabidopsis suecica tRNA-Glu
  4. Arabidopsis thaliana tRNA AT1G09110
  5. Arabis alpina tRNA
  6. Arabis nemorensis Arabis planisiliqua subsp. nemorensis tRNA
  7. Brassica carinata tRNA
  8. Brassica cretica tRNA
  9. Brassica napus tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 21)
  10. Brassica oleracea var. oleracea (wild cabbage) tRNA-Glu for anticodon UUC
  11. Brassica rapa tRNA-Glu for anticodon UUC
  12. Brassica rapa subsp. pekinensis tRNA
  13. Capsella rubella tRNA
  14. Eutrema salsugineum tRNA
  15. Microthlaspi erraticum tRNA
  16. Raphanus sativus (radish) tRNA
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...