Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Eutrema salsugineum tRNA secondary structure diagram

Eutrema salsugineum tRNA URS0000591E4F_72664

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCGAUGUCGUCCAGCGGUUAGGAUAUCUGGCUUUCACCCAGGAGACCCGGGUUCGAUUCCCGGCAUCGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Arabidopsis halleri subsp. gemmifera tRNA-Glu for anticodon UUC
  2. Arabidopsis lyrata subsp. lyrata (lyrate rockcress) tRNA-Glu for anticodon UUC
  3. Arabidopsis suecica tRNA-Glu
  4. Arabidopsis thaliana (thale-cress) tRNA AT1G20170
  5. Arabidopsis thaliana x Arabidopsis arenosa tRNA-Glu
  6. Arabis alpina tRNA
  7. Brassica napus tRNA-Glu (TTC) (tRNA-Glu-TTC-1 1 to 21)
  8. Brassica oleracea var. oleracea tRNA-Glu for anticodon UUC
  9. Brassica rapa tRNA-Glu for anticodon UUC
  10. Brassica rapa subsp. pekinensis tRNA
  11. Capsella rubella tRNA
2D structure Publications